aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160     cctcgag                                                                2167//Output file format   If a plot is not being produced, dan reports the sequence of each   oligomer window, its melting temperature under the specified   conditions and its GC content.   The output is a standard EMBOSS report file.   The results can be output in one of several styles by using the   command-line qualifier -rformat xxx, where 'xxx' is replaced by the   name of the required format. The available format names are: embl,   genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel,   feattable, motif, regions, seqtable, simple, srs, table, tagseq   See: http://emboss.sf.net/docs/themes/ReportFormats.html for further   information on report formats.   By default dan writes a 'seqtable' report file.  Output files for usage example  File: paamir.dan######################################### Program: dan# Rundate: Sat 15 Jul 2006 12:00:00# Commandline: dan#    -sequence tembl:paamir# Report_format: seqtable# Report_file: paamir.dan#########################################=======================================## Sequence: PAAMIR     from: 1   to: 2167# HitCount: 2148#=======================================  Start     End     Tm     GC DeltaG DeltaH DeltaS TmProd Sequence      1      20   64.9   70.0      .      .      .      . ggtaccgctggccgagcatc      2      21   63.7   65.0      .      .      .      . gtaccgctggccgagcatct      3      22   63.7   65.0      .      .      .      . taccgctggccgagcatctg      4      23   66.9   70.0      .      .      .      . accgctggccgagcatctgc      5      24   66.7   70.0      .      .      .      . ccgctggccgagcatctgct      6      25   65.5   70.0      .      .      .      . cgctggccgagcatctgctc      7      26   65.5   70.0      .      .      .      . gctggccgagcatctgctcg      8      27   63.7   65.0      .      .      .      . ctggccgagcatctgctcga      9      28   62.9   60.0      .      .      .      . tggccgagcatctgctcgat     10      29   62.6   65.0      .      .      .      . ggccgagcatctgctcgatc     11      30   61.7   60.0      .      .      .      . gccgagcatctgctcgatca     12      31   60.2   60.0      .      .      .      . ccgagcatctgctcgatcac     13      32   60.2   60.0      .      .      .      . cgagcatctgctcgatcacc     14      33   59.0   55.0      .      .      .      . gagcatctgctcgatcacca     15      34   59.2   55.0      .      .      .      . agcatctgctcgatcaccac     16      35   60.4   60.0      .      .      .      . gcatctgctcgatcaccacc     17      36   58.9   55.0      .      .      .      . catctgctcgatcaccacca     18      37   58.6   55.0      .      .      .      . atctgctcgatcaccaccag     19      38   61.3   60.0      .      .      .      . tctgctcgatcaccaccagc     20      39   62.4   65.0      .      .      .      . ctgctcgatcaccaccagcc     21      40   63.9   65.0      .      .      .      . tgctcgatcaccaccagccg     22      41   64.9   70.0      .      .      .      . gctcgatcaccaccagccgg     23      42   64.3   70.0      .      .      .      . ctcgatcaccaccagccggg     24      43   66.1   70.0      .      .      .      . tcgatcaccaccagccgggc     25      44   67.5   75.0      .      .      .      . cgatcaccaccagccgggcg     26      45   66.1   70.0      .      .      .      . gatcaccaccagccgggcga     27      46   66.3   70.0      .      .      .      . atcaccaccagccgggcgac     28      47   68.6   75.0      .      .      .      . tcaccaccagccgggcgacg     29      48   69.8   80.0      .      .      .      . caccaccagccgggcgacgg     30      49   70.7   80.0      .      .      .      . accaccagccgggcgacggg     31      50   70.5   80.0      .      .      .      . ccaccagccgggcgacggga     32      51   68.6   75.0      .      .      .      . caccagccgggcgacgggaa     33      52   68.6   75.0      .      .      .      . accagccgggcgacgggaac     34      53   68.4   75.0      .      .      .      . ccagccgggcgacgggaact  [Part of this file has been deleted for brevity]   2101    2120   69.9   80.0      .      .      .      . ggccggagcgctgaccctgc   2102    2121   68.7   75.0      .      .      .      . gccggagcgctgaccctgct   2103    2122   65.5   70.0      .      .      .      . ccggagcgctgaccctgcta   2104    2123   63.5   65.0      .      .      .      . cggagcgctgaccctgctat   2105    2124   61.3   60.0      .      .      .      . ggagcgctgaccctgctatt   2106    2125   60.1   60.0      .      .      .      . gagcgctgaccctgctattc   2107    2126   61.7   60.0      .      .      .      . agcgctgaccctgctattcg   2108    2127   63.4   65.0      .      .      .      . gcgctgaccctgctattcgc   2109    2128   61.7   60.0      .      .      .      . cgctgaccctgctattcgct   2110    2129   59.5   55.0      .      .      .      . gctgaccctgctattcgctt   2111    2130   57.1   50.0      .      .      .      . ctgaccctgctattcgcttt   2112    2131   56.4   45.0      .      .      .      . tgaccctgctattcgctttt   2113    2132   54.7   45.0      .      .      .      . gaccctgctattcgctttta   2114    2133   55.0   45.0      .      .      .      . accctgctattcgcttttac   2115    2134   55.9   50.0      .      .      .      . ccctgctattcgcttttacc   2116    2135   54.7   45.0      .      .      .      . cctgctattcgcttttacct   2117    2136   52.0   40.0      .      .      .      . ctgctattcgcttttaccta   2118    2137   51.2   35.0      .      .      .      . tgctattcgcttttacctat   2119    2138   50.9   40.0      .      .      .      . gctattcgcttttacctatc   2120    2139   49.0   35.0      .      .      .      . ctattcgcttttacctatct   2121    2140   49.3   35.0      .      .      .      . tattcgcttttacctatctg   2122    2141   51.1   35.0      .      .      .      . attcgcttttacctatctgt   2123    2142   52.2   40.0      .      .      .      . ttcgcttttacctatctgtg   2124    2143   54.0   45.0      .      .      .      . tcgcttttacctatctgtgg   2125    2144   55.2   50.0      .      .      .      . cgcttttacctatctgtggg   2126    2145   53.9   45.0      .      .      .      . gcttttacctatctgtgggt   2127    2146   52.3   45.0      .      .      .      . cttttacctatctgtgggtg   2128    2147   53.5   45.0      .      .      .      . ttttacctatctgtgggtgg   2129    2148   56.0   50.0      .      .      .      . tttacctatctgtgggtggc   2130    2149   57.8   55.0      .      .      .      . ttacctatctgtgggtggcc   2131    2150   60.1   60.0      .      .      .      . tacctatctgtgggtggccg   2132    2151   63.4   65.0      .      .      .      . acctatctgtgggtggccgc   2133    2152   64.3   70.0      .      .      .      . cctatctgtgggtggccgcc   2134    2153   63.4   65.0      .      .      .      . ctatctgtgggtggccgcca   2135    2154   62.7   60.0      .      .      .      . tatctgtgggtggccgccaa   2136    2155   64.5   65.0      .      .      .      . atctgtgggtggccgccaac   2137    2156   66.5   70.0      .      .      .      . tctgtgggtggccgccaacc   2138    2157   66.8   70.0      .      .      .      . ctgtgggtggccgccaacca   2139    2158   66.8   70.0      .      .      .      . tgtgggtggccgccaaccag   2140    2159   66.8   70.0      .      .      .      . gtgggtggccgccaaccagt   2141    2160   65.9   65.0      .      .      .      . tgggtggccgccaaccagtt   2142    2161   65.6   70.0      .      .      .      . gggtggccgccaaccagttc   2143    2162   65.6   70.0      .      .      .      . ggtggccgccaaccagttcc   2144    2163   64.4   65.0      .      .      .      . gtggccgccaaccagttcct   2145    2164   64.1   65.0      .      .      .      . tggccgccaaccagttcctc   2146    2165   65.4   70.0      .      .      .      . ggccgccaaccagttcctcg   2147    2166   64.2   65.0      .      .      .      . gccgccaaccagttcctcga   2148    2167   62.4   65.0      .      .      .      . ccgccaaccagttcctcgag#---------------------------------------#---------------------------------------  Output files for usage example 2  Graphics File: dan.ps   [dan results]  File: paamir.dan   The header information contains details of the program, date and   sequence   Subsequent lines contain columns of data for each window into the   sequence as it is moved along, giving:     * The start postion of the window     * The end position of the window     * The melting temperature of the window     * The percentage C+G of the window     * The sequence of the window   If the qualifier '-product' is used to make the program prompt for   percent formamide percent of mismatches allowed and product length,   then the output includes the melting temperature of the specified   product.   If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS   of the sequence in the window is also output.Data files   The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in   the entropy/enthalpy/energy data for DNA and RNA respectively.   EMBOSS data files are distributed with the application and stored in   the standard EMBOSS data directory, which is defined by the EMBOSS   environment variable EMBOSS_DATA.   To see the available EMBOSS data files, run:% embossdata -showall   To fetch one of the data files (for example 'Exxx.dat') into your   current directory for you to inspect or modify, run:% embossdata -fetch -file Exxx.dat   Users can provide their own data files in their own directories.   Project specific files can be put in the current directory, or for   tidier directory listings in a subdirectory called ".embossdata".   Files for all EMBOSS runs can be put in the user's home directory, or   again in a subdirectory called ".embossdata".   The directories are searched in the following order:     * . (your current directory)     * .embossdata (under your current directory)     * ~/ (your home directory)     * ~/.embossdataNotes   None.References    1. Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986).       "Predicting DNA Duplex Stability from the Base Sequence."       Proceedings of the National Academy of Sciences USA 83, 3746-3750.    2. Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization       Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168,       761-777, Academic Press, San Diego, California, USA.Warnings   RNA sequences must be submited to this application with the '-rna'   qualifier on the command line, otherwise the sequence will be assumed   to be DNA.Diagnostic Error Messages   None.Exit status   0 if successful.Known bugs   None.See also   Program name                        Description   banana       Bending and curvature plot in B-DNA   btwisted     Calculates the twisting in a B-DNA sequence   chaos        Create a chaos game representation plot for a sequence   compseq      Count composition of dimer/trimer/etc words in a sequence   freak        Residue/base frequency table or plot   isochore     Plots isochores in large DNA sequences   sirna        Finds siRNA duplexes in mRNA   wordcount    Counts words of a specified size in a DNA sequenceAuthor(s)   This program was originally included in EGCG under the names "MELT"   and "MELTPLOT", written by Rodrigo Lopez (rls