D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);                                  we briefly discuss the organization of this                                  file below. If this parameter is specified                                  then Primer3 locally aligns each candidate                                  primer against each library sequence and                                  rejects those primers for which the local                                  alignment score times a specified weight                                  (see below) exceeds MAX-MISPRIMING. (The                                  maximum value of the weight is arbitrarily                                  set to 100.0.)                                  Each sequence entry in the FASTA-format file                                  must begin with an 'id line' that starts                                  with '>'. The contents of the id line is                                  'slightly restricted' in that Primer3 parses                                  everything after any optional asterisk                                  ('*') as a floating point number to use as                                  the weight mentioned above. If the id line                                  contains no asterisk then the weight                                  defaults to 1.0. The alignment scoring                                  system used is the same as for calculating                                  complementarity among oligos (e.g.                                  SELF-ANY). The remainder of an entry                                  contains the sequence as lines following the                                  id line up until a line starting with '>'                                  or the end of the file. Whitespace and                                  newlines are ignored. Characters 'A', 'T',                                  'G', 'C', 'a', 't', 'g', 'c' are retained                                  and any other character is converted to 'N'                                  (with the consequence that any IUB / IUPAC                                  codes for ambiguous bases are converted to                                  'N'). There are no restrictions on line                                  length.                                  An empty value for this parameter indicates                                  that no repeat library should be used.   -maxmispriming      float      The maximum allowed weighted similarity with                                  any sequence in MISPRIMING-LIBRARY.   -pairmaxmispriming  float      The maximum allowed sum of weighted                                  similarities of a primer pair (one                                  similarity for each primer) with any single                                  sequence in MISPRIMING-LIBRARY.   -numnsaccepted      integer    Maximum number of unknown bases (N)                                  allowable in any primer.   -selfany            float      The maximum allowable local alignment score                                  when testing a single primer for (local)                                  self-complementarity and the maximum                                  allowable local alignment score when testing                                  for complementarity between forward and                                  reverse primers. Local self-complementarity                                  is taken to predict the tendency of primers                                  to anneal to each other without necessarily                                  causing self-priming in the PCR. The scoring                                  system gives 1.00 for complementary bases,                                  -0.25 for a match of any base (or N) with an                                  N, -1.00 for a mismatch, and -2.00 for a                                  gap. Only single-base-pair gaps are allowed.                                  For example, the alignment                                  5' ATCGNA 3'                                  ...|| | |                                  3' TA-CGT 5'                                  is allowed (and yields a score of 1.75), but                                  the alignment                                  5' ATCCGNA 3'                                  ...|| | |                                  3' TA--CGT 5'                                  is not considered. Scores are non-negative,                                  and a score of 0.00 indicates that there is                                  no reasonable local alignment between two                                  oligos.   -selfend            float      The maximum allowable 3'-anchored global                                  alignment score when testing a single primer                                  for self-complementarity, and the maximum                                  allowable 3'-anchored global alignment score                                  when testing for complementarity between                                  forward and reverse primers. The 3'-anchored                                  global alignment score is taken to predict                                  the likelihood of PCR-priming primer-dimers,                                  for example                                  5' ATGCCCTAGCTTCCGGATG 3'                                  .............||| |||||                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'                                  or                                  5' AGGCTATGGGCCTCGCGA 3'                                  ...............||||||                                  ............3' AGCGCTCCGGGTATCGGA 5'                                  The scoring system is as for the Maximum                                  Complementarity argument. In the examples                                  above the scores are 7.00 and 6.00                                  respectively. Scores are non-negative, and a                                  score of 0.00 indicates that there is no                                  reasonable 3'-anchored global alignment                                  between two oligos. In order to estimate                                  3'-anchored global alignments for candidate                                  primers and primer pairs, Primer assumes                                  that the sequence from which to choose                                  primers is presented 5' to 3'. It is                                  nonsensical to provide a larger value for                                  this parameter than for the Maximum (local)                                  Complementarity parameter because the score                                  of a local alignment will always be at least                                  as great as the score of a global                                  alignment.   -maxendstability    float      The maximum stability for the five 3' bases                                  of a forward or reverse primer. Bigger                                  numbers mean more stable 3' ends. The value                                  is the maximum delta G for duplex disruption                                  for the five 3' bases as calculated using                                  the nearest neighbor parameters published in                                  Breslauer, Frank, Bloeker and Marky, Proc.                                  Natl. Acad. Sci. USA, vol 83, pp 3746-3750.                                  Primer3 uses a completely permissive default                                  value for backward compatibility (which we                                  may change in the next release). Rychlik                                  recommends a maximum value of 9 (Wojciech                                  Rychlik, 'Selection of Primers for                                  Polymerase Chain Reaction' in BA White, Ed.,                                  'Methods in Molecular Biology, Vol. 15: PCR                                  Protocols: Current Methods and                                  Applications', 1993, pp 31-40, Humana Press,                                  Totowa NJ).   -oligomishyblibrary infile     Similar to MISPRIMING-LIBRARY, except that                                  the event we seek to avoid is hybridization                                  of the internal oligo to sequences in this                                  library rather than priming from them.                                  The file must be in (a slightly restricted)                                  FASTA format (W. B. Pearson and D.J. Lipman,                                  PNAS 85:8 pp 2444-2448 [1988]); we briefly                                  discuss the organization of this file below.                                  If this parameter is specified then Primer3                                  locally aligns each candidate oligo against                                  each library sequence and rejects those                                  primers for which the local alignment score                                  times a specified weight (see below) exceeds                                  INTERNAL-OLIGO-MAX-MISHYB. (The maximum                                  value of the weight is arbitrarily set to                                  12.0.)                                  Each sequence entry in the FASTA-format file                                  must begin with an 'id line' that starts                                  with '>'. The contents of the id line is                                  'slightly restricted' in that Primer3 parses                                  everything after any optional asterisk                                  ('*') as a floating point number to use as                                  the weight mentioned above. If the id line                                  contains no asterisk then the weight                                  defaults to 1.0. The alignment scoring                                  system used is the same as for calculating                                  complementarity among oligos (e.g.                                  SELF-ANY). The remainder of an entry                                  contains the sequence as lines following the                                  id line up until a line starting with '>'                                  or the end of the file. Whitespace and                                  newlines are ignored. Characters 'A', 'T',                                  'G', 'C', 'a', 't', 'g', 'c' are retained                                  and any other character is converted to 'N'                                  (with the consequence that any IUB / IUPAC                                  codes for ambiguous bases are converted to                                  'N'). There are no restrictions on line                                  length.                                  An empty value for this parameter indicates                                  that no library should be used.   -oligomaxmishyb     float      Similar to MAX-MISPRIMING except that this                                  parameter applies to the similarity of                                  candidate internal oligos to the library                                  specified in INTERNAL-OLIGO-MISHYB-LIBRARY.   General qualifiers:  -help                bool       report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose